View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17067_high_6 (Length: 281)
Name: NF17067_high_6
Description: NF17067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17067_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 281
Target Start/End: Original strand, 39775222 - 39775489
Alignment:
| Q |
15 |
atcacatactactttttctttgttcatgcagccctttggtttgattccagtacttgaagatgatgatctcaccctctttggtatgctttcnnnnnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775222 |
atcacatactactttttctttgttcatgcagccctttggtttgattccagtacttgaagatgatgatctcaccctctttggtatgctttctttttttctt |
39775321 |
T |
 |
| Q |
115 |
nnncagttgatacattttttcactctgcatcacc-tttaagtttattcgaaaaatatactttgatgcgcactttcatatttataatcaagcaaatactac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39775322 |
tttcagttgatacattttttcactctgcatcaccctttaagtttattcgaaaaatatactttgatgcgcgctttcatatttataatcaagcaaatactac |
39775421 |
T |
 |
| Q |
214 |
taggnnnnnnntatttattttatgtgatttctgcgcgagaagtgactctgaaatttgagaatttttgt |
281 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39775422 |
taggaaaaaaatatttattttatgtaatttctgcgcgcgaagtgactctgaaatttgagaatttttgt |
39775489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University