View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17067_high_8 (Length: 241)
Name: NF17067_high_8
Description: NF17067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17067_high_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 105 - 241
Target Start/End: Complemental strand, 32929918 - 32929782
Alignment:
| Q |
105 |
aagatagcatattatgtttttaaattggccttaacttatctttacaaaacggatttgtaaggttgataagtgtcaaaatcatgttagtttacctaacatt |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32929918 |
aagatagcatattatatttttaaattggccttgacttatctttacaaaatggatttgtaaggttgataagtgtcaaaatcatgttagtttacataacatt |
32929819 |
T |
 |
| Q |
205 |
tattaaacttgtttggcaagtaatttatataaaaacc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32929818 |
tattaaacttgtttggcaagtaatttatataaaaacc |
32929782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University