View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17068_high_2 (Length: 214)
Name: NF17068_high_2
Description: NF17068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17068_high_2 |
 | |
|
| [»] scaffold0262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 76 - 203
Target Start/End: Original strand, 33451618 - 33451741
Alignment:
| Q |
76 |
ccttattatcaatgatactttgatatgataaataaatgtgattgcagtctcatgtatgtatccaacaaaatgttgttataatttccacataaacccttag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451618 |
ccttattatcaatgatactttgatatgataaataaatgtgattgcagtctcatgt----atccaacaaaatgttgttataatttccacataaacccttag |
33451713 |
T |
|
| Q |
176 |
ttagacctaactacttcaagctaccttt |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
33451714 |
ttagacctaactacttcatgctaccttt |
33451741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 33451526 - 33451591
Alignment:
| Q |
1 |
tatggagatggtttaggagctaactcataagaatgacattccaatatgatttgattagatgcacgt |
66 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
33451526 |
tatggagatagttttggagctaactcataaaaatgacattccaatataatttgattagatgcacgt |
33451591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 86 - 174
Target Start/End: Original strand, 33441411 - 33441496
Alignment:
| Q |
86 |
aatgatactttgatatgataaataaatgtgattgcagtctcatgtatgtatccaacaaaatgttgttataa-tttccacataaaccctta |
174 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
33441411 |
aatgatgctttgatatgataaataaatgtgattgcagtctc----atgtatccaacaaaatattgcaataattttccacataaaccctta |
33441496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 95 - 171
Target Start/End: Complemental strand, 1625 - 1552
Alignment:
| Q |
95 |
ttgatatgataaataaatgtgattgcagtctcatgtatgtatccaacaaaatgttgttataa-tttccacataaaccc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
1625 |
ttgatatgataaataaatgtgattgcagcgtc----atgtatccaacaaaatattgcaataattttccacataaaccc |
1552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University