View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17069_low_16 (Length: 284)
Name: NF17069_low_16
Description: NF17069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17069_low_16 |
 |  |
|
| [»] scaffold1155 (1 HSPs) |
 |  |  |
|
| [»] scaffold0345 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 29021996 - 29021738
Alignment:
| Q |
18 |
acttattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29021996 |
acttattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaa |
29021897 |
T |
 |
| Q |
118 |
cctcacatctctcaatttctcccaccaagatatctttcccgcagatggtttgcgagctttcagtaaaaacattactactttgatctctctcacttgttac |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29021896 |
cctcacatctctcaatttctccgaccaagatatctttcccgcagatggtttgcgagctttcagcaaaaacattactactttgacctctctcacttgttac |
29021797 |
T |
 |
| Q |
218 |
caccttgaaaccctcaatagcactcatctcttcttcattgctgattgcttccctttgct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
29021796 |
caccttgaaaccctcaatagcactcatctctttcttattgctgattgcttccctttgct |
29021738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 28661054 - 28661240
Alignment:
| Q |
21 |
tattccctagattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaacct |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| || ||||| ||| |||| ||||| ||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
28661054 |
tattccctagattctccaacctgaactctctcgacctaacatgttactacggtaaccttgactcacttctatttcaaatctctagcttcccgttgaacct |
28661153 |
T |
 |
| Q |
121 |
cacatctctcaatttctcccaccaagatatctttcccgcagatggtttgcgagctttcagtaaaaacattactactttgatctctct |
207 |
Q |
| |
|
||||||||||||||||| | || || |||||||||||||| |||||||| |||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
28661154 |
cacatctctcaatttctgcaacaaaaatatctttcccgcacatggtttgggagctttcagccaaaacattacaactttgacctctct |
28661240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 275
Target Start/End: Original strand, 28695545 - 28695637
Alignment:
| Q |
183 |
aaaacattactactttgatctctctcacttgttaccaccttgaaaccctcaatagcactcatctcttcttcattgctgattgcttccctttgc |
275 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||| |||||||| ||| ||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28695545 |
aaaacattacaactatgacctctctcacttgttcccaccttgcaactctccatagcactgatctcttcttcattgctgattgcttccctttgc |
28695637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 276
Target Start/End: Original strand, 28673346 - 28673388
Alignment:
| Q |
234 |
atagcactcatctcttcttcattgctgattgcttccctttgct |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28673346 |
atagcaccgatctcttcttcattgctgattgcttccctttgct |
28673388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1155 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold1155
Description:
Target: scaffold1155; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 96 - 173
Target Start/End: Original strand, 1821 - 1898
Alignment:
| Q |
96 |
aaatctctcgcttccctttgaacctcacatctctcaatttctcccaccaagatatctttcccgcagatggtttgcgag |
173 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
1821 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
1898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 96 - 173
Target Start/End: Complemental strand, 8395 - 8318
Alignment:
| Q |
96 |
aaatctctcgcttccctttgaacctcacatctctcaatttctcccaccaagatatctttcccgcagatggtttgcgag |
173 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
8395 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
8318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 96 - 173
Target Start/End: Original strand, 30584 - 30661
Alignment:
| Q |
96 |
aaatctctcgcttccctttgaacctcacatctctcaatttctcccaccaagatatctttcccgcagatggtttgcgag |
173 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
30584 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
30661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 21833269 - 21833331
Alignment:
| Q |
153 |
ttcccgcagatggtttgcgagctttcagtaaaaacattactactttgatctctctcacttgtt |
215 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
21833269 |
ttcccgcagatgggttgcgagtttttgcacaaaacattactactttgacctctctcacttgtt |
21833331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 276
Target Start/End: Original strand, 2373556 - 2373589
Alignment:
| Q |
243 |
atctcttcttcattgctgattgcttccctttgct |
276 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
2373556 |
atctcttcttcattgctgattgtttccctttgct |
2373589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 19467423 - 19467485
Alignment:
| Q |
153 |
ttcccgcagatggtttgcgagctttcagtaaaaacattactactttgatctctctcacttgtt |
215 |
Q |
| |
|
|||||||| |||| ||||||| ||||| | |||| ||||| ||||||| |||||||||||||| |
|
|
| T |
19467423 |
ttcccgcaaatgggttgcgagttttcactcaaaatattacaactttgacctctctcacttgtt |
19467485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 145
Target Start/End: Complemental strand, 9581878 - 9581762
Alignment:
| Q |
29 |
agattctccaacctcaactctctcgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaacctcacatctc |
128 |
Q |
| |
|
|||||| ||||||||| ||| |||||||| | ||| ||| ||| ||||| || |||||| | |||| ||||| | ||||| ||||| |||||||| | |
|
|
| T |
9581878 |
agattcaccaacctcacctccctcgacctcacgtggtacagaggtaacctcaacgagcttctgtatcaagtctcttgtttcccattgaaactcacatcgc |
9581779 |
T |
 |
| Q |
129 |
tcaatttctcccaccaa |
145 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
9581778 |
tcaatctctcccaccaa |
9581762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University