View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_high_25 (Length: 322)
Name: NF1706_high_25
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 11 - 162
Target Start/End: Complemental strand, 27715324 - 27715172
Alignment:
| Q |
11 |
caaaggaaggatcctcaatgtcaggaagacgagtggtgtggttcctgaattgata-ctgttagtttgtgcagtttttgtttgccggtgttttctgtcatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27715324 |
caaaggaaggatcctcaatgtcaggaagacgagtggtgtggttcctgaattgatatctgttagtttgtgcagtttttgtttgccggtgttttctgtcatg |
27715225 |
T |
 |
| Q |
110 |
cgtagtctgtcaagcgcttttgtcctggctgttttgagcataggaattcgggt |
162 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
27715224 |
cgcagtctgtaaagcgcttttgtcctggctgttttgagcattgcaattcgggt |
27715172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 80 - 209
Target Start/End: Original strand, 44753634 - 44753763
Alignment:
| Q |
80 |
agtttttgtttgccggtgttttctgtcatgcgtagtctgtcaagcgcttttgtcctggctgttttgagcataggaattcgggtaggcaaagctgttgtgt |
179 |
Q |
| |
|
||||||||||| || |||||||| |||||| |||||||||||||||||||| || |||||||||||||||||| | |||||||||||||| || | | | |
|
|
| T |
44753634 |
agtttttgtttaccagtgttttcggtcatgtgtagtctgtcaagcgcttttttcttggctgttttgagcatagcagttcgggtaggcaaaactttattat |
44753733 |
T |
 |
| Q |
180 |
agggggtgttctgcgcaacattgaaggtgt |
209 |
Q |
| |
|
| |||||||||||||||||| | ||||||| |
|
|
| T |
44753734 |
aaggggtgttctgcgcaacaataaaggtgt |
44753763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 204 - 304
Target Start/End: Original strand, 44753839 - 44753939
Alignment:
| Q |
204 |
aggtgtctgagaagtgcactctgctgctgccccatggtcttggtgtatattttcttgatggaattatagcaggtctgcgttgcgttaaatgacacttgga |
303 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||| |||||||||| |||||||| | | |||||||||| || |||||| ||||| |||||||||| |
|
|
| T |
44753839 |
aggtgtttgagaagtgcactctgctgctgttccatggccttggtgtattttttcttgttcgcattatagcagatcagcgttggcttaaaggacacttgga |
44753938 |
T |
 |
| Q |
304 |
t |
304 |
Q |
| |
|
| |
|
|
| T |
44753939 |
t |
44753939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University