View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_high_32 (Length: 285)
Name: NF1706_high_32
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 48953140 - 48953401
Alignment:
| Q |
16 |
aatatgatggcaagttggtggatgagaacatgatcattcttagaatgcgaatccgtgagattgagatggtggaaacaaagactaaagatcattctgattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953140 |
aatatgatggcaagttggtggatgagaacatgatcattcttagaatgcgaatccgtgagattgagatggtggaaacaaagactaaagatcattctgattg |
48953239 |
T |
 |
| Q |
116 |
gactgaatgggagaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgttgatgaacactagacctgccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953240 |
gactgaatgggagaagaagtattttgagaattatggttcggatgtatgtgatgcagttggattgttgcaaagaatgttgatgaacactagacctgccttg |
48953339 |
T |
 |
| Q |
216 |
gttgtgggcatattagctctgtttatgctaagcatgtcaatgtccatgtcactactgatgat |
277 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48953340 |
gctgtgggcatattagctctgtttatgctaagcatgtcaatgtccatgtcactacttatgat |
48953401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University