View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_high_56 (Length: 224)
Name: NF1706_high_56
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 40970393 - 40970206
Alignment:
| Q |
17 |
aacaatagcaacaactgtctcgtgctcagtgggcagagta-------ttatattatagtgcaagtatgtctgtattaataatcttcactttaattagggg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40970393 |
aacaatagcaacaactgtctcgtgctcagtgggctgagtagtgagtattatattatagtgcaagt----ctgtattaataatcttcactttaattagggg |
40970298 |
T |
|
| Q |
110 |
aaaagagcaccgt---tctaatttgtcctaagcgtataaaaaataactaaagatcacgaaatcctaaaactagcacagccattgcatcatca |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40970297 |
aaaagagcaccgtagttctaatttgtcctaagcgtataaaaaataactaaagatcacgaaatcctaaaactagcacagccattgcatcatca |
40970206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University