View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_high_59 (Length: 209)
Name: NF1706_high_59
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 48953194 - 48952996
Alignment:
| Q |
1 |
cggattcgcattctaagaatgattatgttctcatccaacaacttgccatcatattgatggccaaatgggtctctttttgatgcacagatataactcttgt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48953194 |
cggattcgcattctaagaatgatcatgttctcatccaccaacttgccatcatattgttggccaaatgggtctctttttgatgcacagataaaactcttgt |
48953095 |
T |
 |
| Q |
101 |
tactatgtgaattgaatggtgtacttcggcgcattatatttcccgaagaagggcttgatagaagcacatgcgaggatataaatgttgcttgcattttct |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48953094 |
tattatgtgaattgaatggtgtacttcggcgcattatatttcccgaagaagggcttgatagaagcacatgcgaggatataaatgttgcttgcattttct |
48952996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University