View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_30 (Length: 319)
Name: NF1706_low_30
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 30240132 - 30240259
Alignment:
| Q |
1 |
atatttctttgcaaaaatagtagttaaaagtctctaggtagtaataaagtagtataatgtacatttttcacatgatatgcttatctatacctatctagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30240132 |
atatttctttgcaaaaatagtagttaaaagtctctaggtagtaataaagtagtataatgtacatttttcacatgatatgcttatctatacctatctacat |
30240231 |
T |
 |
| Q |
101 |
cttgggttgtcaaactcaagattttact |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
30240232 |
cttgggttatcaaactcaagattttact |
30240259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 309
Target Start/End: Original strand, 30240372 - 30240425
Alignment:
| Q |
256 |
aacggaagtttggtgaagctgattaaagacagaattgaaacaaaaggtgatgat |
309 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30240372 |
aacgaaagcttgatgaagctgattaaagacaaaattgaaacaaaaggtgatgat |
30240425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 245
Target Start/End: Original strand, 30240323 - 30240377
Alignment:
| Q |
191 |
atatgtcataaataactcaaagtttcaagtcagcaaattacttaaaattaacgaa |
245 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
30240323 |
atatatcataaatgactcaaagtttcaagtccacaaattacttaaagttaacgaa |
30240377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University