View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_41 (Length: 261)
Name: NF1706_low_41
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 33655042 - 33655287
Alignment:
| Q |
1 |
tcttgtttttcttcttctttttcttatgagaatccatttcttggtcatgaacgatgtgagagcgatccccgtttggaggccattgcatattcccaggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655042 |
tcttgtttttcttcttctttttcttatgagaatccatttcttggtcatgaacaatgtgagagcgatccccgtttggaggccattgcatattcccaggata |
33655141 |
T |
 |
| Q |
101 |
atacggagacggaacctgcataccaggatacatgtatccttggtatggaggtgtttgttgaaatccatgaccctgaaaattgtgaatgtagtgtggatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33655142 |
atacggagacggaacctgcataccaggatacatgtatccttggtatggaggcgtttgttgaaatgcatgaccctgaaaattgtgaatgtactgtggatga |
33655241 |
T |
 |
| Q |
201 |
tggttcggccatgacctcggcatttgagcccttccatcggatgatg |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33655242 |
tggttcggccatgacctcagcatttgagcccttccatcggatgatg |
33655287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University