View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_47 (Length: 245)
Name: NF1706_low_47
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 26306571 - 26306346
Alignment:
| Q |
1 |
tcactctttaattttatctatgtagagttcttgttatcatgtgttatgtagcattaggcctgcattatatttaccttatattataatactatatgataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306571 |
tcactctttaattttatctatgtaaagttcttgttatcttgtgttatgtagcattaggcctgcattatatttaccttatattataatactatatgataaa |
26306472 |
T |
|
| Q |
101 |
gatatcagtattatacgttgatatgttttggtaacagttcttttaccagcatgccggcagagagacaaagatctcttttgggtttttccatgttagttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26306471 |
gatatcagtattatacgttgatatgttttggtaacagttcttttaccagcatgccggcagagagacaaagatctcttttgggtttttccatgttagttgt |
26306372 |
T |
|
| Q |
201 |
ttttcttaatattattatataataat |
226 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
26306371 |
ttttcttagtattattatataataat |
26306346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University