View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_50 (Length: 239)
Name: NF1706_low_50
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 109 - 234
Target Start/End: Original strand, 39112780 - 39112907
Alignment:
| Q |
109 |
acttgctgtgctaatgtttgcttttttgtggctttat--agttcaataatggctgctcacgacgcttctgataacaatttagggttttctgtagactccc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39112780 |
acttgctgtgctaatgtttgcttttttgtggctttatgtagttcaataatggctgctcacgacgcttctgataacaatttagggttttctgtagactccc |
39112879 |
T |
 |
| Q |
207 |
aactggatgacaatgtccctttgcttct |
234 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
39112880 |
aactggatgacaatgtccctttgattct |
39112907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 39112672 - 39112715
Alignment:
| Q |
1 |
aattcaaactttactacattgctttgtgattcaaacttgaaacc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39112672 |
aattcaaactttactacattgctttgtgattcaaacttgaaacc |
39112715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 39103699 - 39103744
Alignment:
| Q |
2 |
attcaaactttactacatt---gctttgtgattcaaacttgaaacc |
44 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39103699 |
attcaaactttactacattaatgctttgtgattcaaacttgaaacc |
39103744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 228
Target Start/End: Original strand, 32984616 - 32984699
Alignment:
| Q |
145 |
tagttcaataatggctgctcacgacgcttctgataacaatttagggttttctgtagactcccaactggatgacaatgtcccttt |
228 |
Q |
| |
|
||||||||||||||||||| | | ||||| ||||| | |||||||||| || ||||||| || ||||||| ||||||||||| |
|
|
| T |
32984616 |
tagttcaataatggctgctgataaagcttcggataatcagttagggttttgtgaagactccaaaatggatgataatgtcccttt |
32984699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University