View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_55 (Length: 235)
Name: NF1706_low_55
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 6722195 - 6721992
Alignment:
| Q |
15 |
acagacaaggaatgatagtgtacgatagattgaggcaattagtgaattgtgacatttgcgtcgccgatcgtgaatgtattacaaatgtaacttatgacca |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||| || ||||| ||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
6722195 |
acagacaaggaatgatattgtacgatagattgaggcaattagtgaactgtaacgtttgcctcgccaatcgtgaatgcattacaaatggaacttatgacca |
6722096 |
T |
|
| Q |
115 |
catctttcaaggcgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacatccaaagagaagggatcattaataaatgatc |
214 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6722095 |
catctctcaagacgaatcctccttctttagcacttacgtgaacgtcctatcttacttgattcttcgacatccatagagaagggatcattaataaatgatc |
6721996 |
T |
|
| Q |
215 |
taca |
218 |
Q |
| |
|
|||| |
|
|
| T |
6721995 |
taca |
6721992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University