View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1706_low_57 (Length: 226)
Name: NF1706_low_57
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1706_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 44232756 - 44232550
Alignment:
| Q |
1 |
aggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtgtacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232756 |
aggcagaggaaagggagtgatggatattcaatagcactccaactttataattttctttatgtaatctttcacaatgctgtaaagcaacaatttgtgtacc |
44232657 |
T |
 |
| Q |
101 |
aataaagcaactatcaacaagcatttttagactannnnnnnnnatttataaaatttatcttctgagctgaagtgaagaataccatgttgcttgttacaac |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232656 |
aataatgcaactatcaacaagcatttttagact---tttttttatttataaaatttatcttctgagctgaagtgaagaataccatgttgcttgttacaac |
44232560 |
T |
 |
| Q |
201 |
aaattgcatc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
44232559 |
aaattgcatc |
44232550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University