View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707-Insertion-24 (Length: 61)
Name: NF1707-Insertion-24
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707-Insertion-24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 5e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 49167914 - 49167864
Alignment:
| Q |
8 |
gtattttcatctccttgaattttgtgttcaacaaaaattggagaatttccc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49167914 |
gtattttcatctccttgaattttgtgttcaacaaaaattggagaatttccc |
49167864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University