View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707-Insertion-28 (Length: 429)
Name: NF1707-Insertion-28
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707-Insertion-28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 8 - 325
Target Start/End: Complemental strand, 2488392 - 2488075
Alignment:
| Q |
8 |
gcatgctccaaatttagccaaatagacatagcaagggagcaatctctcaatgctcattgttgccttatttttgttcatatgagctgctacgggttataat |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488392 |
gcatgctccacatttagccaaatagacatagcaagggagcaatctctcaatgctcattgttgccttatttttgttcatatgagctgctacgggttataat |
2488293 |
T |
|
| Q |
108 |
ataattccatgcaatctcaaaaagttcaaatcttttcgacactttacatttgagagtttagaatttaggaatgtaattttcttgtacaaactatgctagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2488292 |
ataattccatgcaatctcaaaaagttcaaatcttttcgacactttacatttgagagtttagaatttaggaatgtaattttcttgttcaaactatgctagt |
2488193 |
T |
|
| Q |
208 |
gtcaacaatttttatgttggattagtctatacaaagttttggtttgattttaattgagtcccttattagtagatagagatattaatctcttgaattaatc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2488192 |
gtcaacaatttttatgttggattagtctatacaaagttttggtttgattttaattgaatcccttattagtagatagagaaattaatctcttgaattaatc |
2488093 |
T |
|
| Q |
308 |
gatctttagttggatacc |
325 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
2488092 |
gatctttagtcggatacc |
2488075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 387 - 429
Target Start/End: Complemental strand, 2488013 - 2487971
Alignment:
| Q |
387 |
gttaaagaaattcaaatatagctagagatgagtacatattata |
429 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2488013 |
gttaaagaaattcaaatatagctagagataagtacatattata |
2487971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 12623302 - 12623351
Alignment:
| Q |
9 |
catgctccaaatttagccaaatagacatagcaagggagcaatctctcaat |
58 |
Q |
| |
|
|||||| || ||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
12623302 |
catgcttcacatttagccaaagaggcataacaagggagcaatctctcaat |
12623351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University