View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707-Insertion-30 (Length: 261)
Name: NF1707-Insertion-30
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707-Insertion-30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 64 - 224
Target Start/End: Complemental strand, 10766525 - 10766364
Alignment:
| Q |
64 |
acaatgatattatgattttgttgaagagtttacgtcaaaatcacaatgatatataatgattctgataatcttcctgtcaatttaaatttgcactcagtcg |
163 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
10766525 |
acaatgatattgtgattttgtagaagagtttacgtcaaaatcacattgatatataatgattctgataatcttccggtcaattcaaacttgcactcagtcg |
10766426 |
T |
 |
| Q |
164 |
attgtactttccttaatattagtatta-tccatttcatttcaataagtatgattgtaaccat |
224 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10766425 |
attgtattttccttaatattagtattattccatttcatttcaataagtatgattgtaaccat |
10766364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 10766651 - 10766571
Alignment:
| Q |
8 |
acgtggactgcaaatgagcttatctcaatattctcaaaaagaagcatacaattaaaacaatgatattatgattttgttgaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10766651 |
acgtggactgcaaatgagcttatctcaatattctcaaaaagaagcatacaattaaaacaataatattatgattttgttgaa |
10766571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University