View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707-Insertion-35 (Length: 163)
Name: NF1707-Insertion-35
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707-Insertion-35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 49238 - 49082
Alignment:
| Q |
7 |
aatatcaaacaatacttatgtatggttgcagatggacacattgcaacgcctgtgaaggtgttaggatcatccaatgtggccccatataacaaagatacga |
106 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49238 |
aatatcaaacaatacttatctatggttgcagatggacacattgcaacgcctgtgaaggtcttgggatcatccaatgtgggcccatataacaaagatacga |
49139 |
T |
 |
| Q |
107 |
tggagatttttggcgataaacactcgtatatgtcacctccctccaagccaaccacca |
163 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49138 |
tggaggttttgggcgataaacactcgtacatgtcacctccctccaagccaaccacca |
49082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University