View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17071_high_8 (Length: 330)
Name: NF17071_high_8
Description: NF17071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17071_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 96 - 204
Target Start/End: Complemental strand, 13362186 - 13362076
Alignment:
| Q |
96 |
atttctcaaacatttttattgaaatcatggatccaattccctttggnnnnnnnn--tgagaaacaaaatccagcaaagcagagaatataaatgtttatag |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13362186 |
atttttcaaacatttttattgaaatcatggatccaattccctttggaaaaaaaaaatgagaaacaaaatccagcaaagtagagaatataaatgtttatag |
13362087 |
T |
 |
| Q |
194 |
atctgggtttg |
204 |
Q |
| |
|
||||||||||| |
|
|
| T |
13362086 |
atctgggtttg |
13362076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 13362317 - 13362227
Alignment:
| Q |
21 |
acatcatcaacaacaataacattcaccgtaacacgaagcttgttcctcaatatccattc--atgcccatgactctaaatttctcaaacatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
13362317 |
acatcatcaacaacaataacattcaccataacatgaagcttgttcctcaatatccattcatatacccatgactccaaatttctcaaacatt |
13362227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 261 - 299
Target Start/End: Complemental strand, 13362019 - 13361981
Alignment:
| Q |
261 |
ggtttttgttctctttaatgcttatggaattgctttgct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13362019 |
ggtttttgttctctttaatgcttatggaattgctttgct |
13361981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 96 - 204
Target Start/End: Complemental strand, 50056684 - 50056571
Alignment:
| Q |
96 |
atttctcaaacatttttattgaaatcatggatccaattccctttgg-nnnnnnnntgagaaacaaaatccagcaaagcagagaat----ataaatgttta |
190 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
50056684 |
atttgtcaaacatttttattgaaatcatggatccaattccctttggaaacaaagatgagaaacaaaatccaggaaagcagagaatatacatacatgttta |
50056585 |
T |
 |
| Q |
191 |
tagatctgggtttg |
204 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50056584 |
tagatctgggtttg |
50056571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 29 - 109
Target Start/End: Complemental strand, 50056805 - 50056725
Alignment:
| Q |
29 |
aacaacaataacattcaccgtaacacgaagcttgttcctcaatatccattcatgcccatgactctaaatttctcaaacatt |
109 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
50056805 |
aacaacaataacattcaccataacttgaagcctgttcctcaatatccattcatacctatgactccaaatttctcaaacatt |
50056725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 299
Target Start/End: Complemental strand, 50056513 - 50056475
Alignment:
| Q |
261 |
ggtttttgttctctttaatgcttatggaattgctttgct |
299 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50056513 |
ggtttttattctctttaatgcttatggaattgctttgct |
50056475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University