View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17072_high_38 (Length: 228)

Name: NF17072_high_38
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17072_high_38
NF17072_high_38
[»] chr1 (1 HSPs)
chr1 (34-209)||(7429294-7429470)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 34 - 209
Target Start/End: Complemental strand, 7429470 - 7429294
Alignment:
34 caggttctgagagtctgacaagggtcgtgggagagtcagaatcgatcaaagacaaatgataattcaactttagg-acttgtattccatatttttagttcc 132  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
7429470 caggttctgagagtttgacaagggtcgtgggagagtcagaatcgatcaaagacaaatgataattcaactttagggacttgtattccatatttttagttcc 7429371  T
133 acaaattgaaacatctactttttagttgcatggttaaaaaggagaatgacatgtagacgaggcaacagaggatgcca 209  Q
    || |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||  ||| ||||||||||    
7429370 acgaattgaaacatctactttctagttgcatggttaaaaaggagaatgacatgtagaccagataacggaggatgcca 7429294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University