View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_high_39 (Length: 217)
Name: NF17072_high_39
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 28 - 198
Target Start/End: Original strand, 9627617 - 9627786
Alignment:
| Q |
28 |
gaaaagaagaatcaatgagcaactgatataaagacaaagaaagtgagagtggcggccacaattaacaagaattttagagtatttaaggttttatataaga |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9627617 |
gaaaagaagaatcaatgagcaactgatataaagacaaagaaagtgagagtggtggccacaattaacaagaacattagagtatttaaggttttatataaga |
9627716 |
T |
 |
| Q |
128 |
gaacttcttttttccattcttaattactctcccccgtgctctaaaattcttttttactcagttgggattct |
198 |
Q |
| |
|
||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9627717 |
gaatttc-tttttccgttcttaattactctcccccgtgctctaaaattcttttttactccgttgggattct |
9627786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University