View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17072_high_42 (Length: 211)

Name: NF17072_high_42
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17072_high_42
NF17072_high_42
[»] chr1 (1 HSPs)
chr1 (1-121)||(2451329-2451449)
[»] chr7 (1 HSPs)
chr7 (1-39)||(23730003-23730041)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 2451329 - 2451449
Alignment:
1 gtatgaagtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtgggagtcttgtgtttgatcgattatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2451329 gtatgaagtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtgggagtcttgtgtttgatcgattatc 2451428  T
101 cttaatctgatcatgggtgtg 121  Q
    |||||||||||||||||||||    
2451429 cttaatctgatcatgggtgtg 2451449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 23730003 - 23730041
Alignment:
1 gtatgaagtgaaaattggaaaacaagaacaaattttcaa 39  Q
    |||||||||||||||||||||||||||||||||||||||    
23730003 gtatgaagtgaaaattggaaaacaagaacaaattttcaa 23730041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University