View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_29 (Length: 280)
Name: NF17072_low_29
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 41936110 - 41936324
Alignment:
| Q |
8 |
attatactacgatggtaataaaaaaggaaaagaggtgcatattaaatgcactttcatatgtactgccataaattttcataacatgcatgtaatgtaaatc |
107 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936110 |
attatactacgatgctaataaaa-aggaaaagaggtgcatattaaatgcactttcatatgtactgccataaattttcataacatgcatgtaatgtaaatc |
41936208 |
T |
|
| Q |
108 |
ttgatttagataaaacctaatcaattaaattcacaaaatactgatttttattattatacaaaagtactaatattatcatcaaaagagtaaatattttaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936209 |
ttgatttagataaaacctaatcaattaaattcacaaaatactgatttttattattatacaaaagtactaatattatcatcaaaagagtaaatattttaag |
41936308 |
T |
|
| Q |
208 |
atgcggtgttactcta |
223 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
41936309 |
atgcagtgttactcta |
41936324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University