View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_3 (Length: 647)
Name: NF17072_low_3
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 364 - 569
Target Start/End: Original strand, 51029663 - 51029865
Alignment:
| Q |
364 |
gatggaagatcttgaaattttattgtttcttgagaagactggttctattcttttttaacttgaattcttactttaaataatgtacttgtttattatttga |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51029663 |
gatggaagatcttgaaattttattgtttcttgagaagactggttctattcttttttaacttgaattcttactttaaataatgtacttgtttattatttga |
51029762 |
T |
|
| Q |
464 |
aaacccgcccaaaaataattatgagagcgagaaaataaattaagaaaacctatgatactggtggatatttttccctgttaaagaataaagacgtggaaca |
563 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51029763 |
aaacccgcccaaa---aattatgagagcgagaaaataaattaagaaaacctatgatactggtggatatttttccctgttaaagaataaagacgtggaaca |
51029859 |
T |
|
| Q |
564 |
ctcgcc |
569 |
Q |
| |
|
|||||| |
|
|
| T |
51029860 |
ctcgcc |
51029865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 67 - 127
Target Start/End: Original strand, 51029359 - 51029419
Alignment:
| Q |
67 |
ttataagttttgttccttacaaataaatatatttcttttgacataaatgataagactaaaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51029359 |
ttataagttttgttccttacaaataaatatatttcttttgacataaatgataagactaaaa |
51029419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 608 - 637
Target Start/End: Original strand, 51029904 - 51029933
Alignment:
| Q |
608 |
tgcttttttggatgatgcaagtttcatatt |
637 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51029904 |
tgcttttttggatgatgcaagtttcatatt |
51029933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University