View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_31 (Length: 262)
Name: NF17072_low_31
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 2227171 - 2227014
Alignment:
| Q |
22 |
agttatctttttaattacaaaaaattaacttcagatcaattattaggtaaagtgaaaattcaggtttggtgttagattaaatcaaagattaaaatcttaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2227171 |
agttatctttttaattacaaaaaattaacttcagatcaattattaggtaaagtgaaaattcaggtttggtgttggattaaatcaaagattaaaatcttaa |
2227072 |
T |
 |
| Q |
122 |
aaagcatgactttaatcattggtgagttaatccatttggttgtctttgagttcgcggta |
180 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
2227071 |
aaagcatgacttgaatcattggtgagttaatccatttggttgtc-ttgagttcgtggta |
2227014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 115
Target Start/End: Original strand, 32881693 - 32881738
Alignment:
| Q |
70 |
aaagtgaaaattcaggtttggtgttagattaaatcaaagattaaaa |
115 |
Q |
| |
|
|||||| ||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
32881693 |
aaagtggaaatttaagtttggtgttggattaaatcaaagattaaaa |
32881738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University