View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_33 (Length: 253)
Name: NF17072_low_33
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 607142 - 606921
Alignment:
| Q |
19 |
atccataactctgaaacaaaatcaaaaattgaatcgtcgtgtctttattgtgt--atttgatccacttgtgactttgtgaggatatatatgatttgcgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607142 |
atccataactctgaaacaaaatcaaaaattgaatcgtcgtgtctttattgtgtgtatttgatccacttgtgactttgtgaggatatatatgatttgcgaa |
607043 |
T |
 |
| Q |
117 |
agagatatgtgatgtgagtagtgctcatcttgttaaagtgggtagaaatagcatacttccatcataattccgttgacaactcatccatcctacctcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
607042 |
agagatatgtgatgtgagtagtgctcatcttgttaaagtgggtagaaatagcatacttccatcataattccgttgacaactcatccatcctacctcatat |
606943 |
T |
 |
| Q |
217 |
gtacctgtaacctattcctttg |
238 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
606942 |
gtacctgtaatctattcctttg |
606921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University