View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_37 (Length: 242)
Name: NF17072_low_37
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 26920484 - 26920601
Alignment:
| Q |
18 |
ggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920484 |
ggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaa |
26920583 |
T |
 |
| Q |
118 |
tggtgcaattgatgagga |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26920584 |
tggtgcaattgatgagga |
26920601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 26920659 - 26920703
Alignment:
| Q |
187 |
aaagggatattatcaactactcctaacaaaccagaaggagtgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26920659 |
aaagggatattatcaactactcctaacaaaccagaaggagtgatg |
26920703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University