View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17072_low_42 (Length: 216)
Name: NF17072_low_42
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17072_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 12365623 - 12365430
Alignment:
| Q |
1 |
cggtggaagattcccatgacttatacaaatagtatcaatttgagtcttttctctgtcttggagattaataaaactgatataatccattaagtctttggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
12365623 |
cggtggaagattcccatgacttatacatgtagtatcaatttgagtcttttctctgtgatggagattagtaaaattgatataatccattaagtctttggta |
12365524 |
T |
|
| Q |
101 |
acctttaagcttggaggataatcatcaatagtttcccatatatctgcataatttttacaaatgaggaatttagtcctaggatctatgtgatatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
12365523 |
acctttaagcttggaggataatcatcaatagtttcccatatatctgcataatttttacaaataaggaatttagtcctgggatctatctgatatg |
12365430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University