View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17073_high_5 (Length: 320)
Name: NF17073_high_5
Description: NF17073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17073_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 1506992 - 1506873
Alignment:
| Q |
1 |
tatatgagaaaattaagctttagtcttattggtaattgaaatcaaaatacattacctttatcttttattaccattagtggaggcttcatcctctacaatg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||| ||| |
|
|
| T |
1506992 |
tatatgagaaaattaagcttcagtcttattggtaattgaaatcaaaatgcattacctttattttcgattaccattagtggaggcttcatcctctacgatg |
1506893 |
T |
|
| Q |
101 |
cttgttgtttgtctcttaag |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1506892 |
cttgttgtttgtctcttaag |
1506873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 204 - 295
Target Start/End: Complemental strand, 1506789 - 1506698
Alignment:
| Q |
204 |
agtgctggaaaaattatcgttaatgctattccatttttccttattaattagaagaaatagtcacgttaggacgttatgctaacaaataccaa |
295 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
1506789 |
agtgctggaaaaatgatcgttaatgatattccatttttccttattaattagaagaaatagtcacgtcaggacgtcatgctaacaaataccaa |
1506698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University