View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17073_low_10 (Length: 236)
Name: NF17073_low_10
Description: NF17073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17073_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32472014 - 32472234
Alignment:
| Q |
1 |
cccaccacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcgccggtaacaaattccatttcttcttcc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32472014 |
cccactacatcaacctttgtcatccctagggttctcactccttgccgtgacttcaaccttgctctctccgtcgccggtaacaaattccatttcttcttcc |
32472113 |
T |
 |
| Q |
101 |
atgtacaacaaaccaccaatccaccagtctccgttagcccgtaaccatgactcactgtaaaccctaaagcttctgtacggtggagtacgggcgcaggcgg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| || |
|
|
| T |
32472114 |
atgtacaacaaaccaccaatccaccggtctccgttagcccgtaaccatgactcactgtaaaccctaaagcttctgtacggtggagtactgccgcaggtgg |
32472213 |
T |
 |
| Q |
201 |
cggtgctccagctgttaaaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32472214 |
cggtgctccagctgttaaaat |
32472234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University