View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17073_low_11 (Length: 229)
Name: NF17073_low_11
Description: NF17073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17073_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 43339593 - 43339408
Alignment:
| Q |
17 |
ttctttctactagtttttaatgtgtaaatagatctagtgtttcactttttagtgcaagagtttaataccatgtttttccattattaattactacatgcca |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43339593 |
ttctttcttctagtttttaatgtgtaaatagatctagtgtttcactttttagtgcaagagtttaataccatgtttt-ccattattaattactacatgcca |
43339495 |
T |
 |
| Q |
117 |
tttataacatgcaaatcctcatccacacacaaaatatattggcaaatattttagccatgatatctctttgtaccatgtactagtagc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43339494 |
tttataacatgcaaatcctcatccacacacaaaatatattggcaaatattttagccatgatatctctttgtaccatgtactagtagc |
43339408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University