View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17075_low_11 (Length: 238)
Name: NF17075_low_11
Description: NF17075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17075_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 10759864 - 10759669
Alignment:
| Q |
1 |
atcaactcacttaaatatgtaaataaaa-tctaaatacgcattttggtaattggtatatattaatctaaatatatatgtgcaatgtataacttttcgtaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
10759864 |
atcaactcacttaaatatgtaaataaaaatctaaatacgcattttggtaatc--tatatat--------atatatatgcgcaatgtataacttttcgtaa |
10759775 |
T |
 |
| Q |
100 |
atgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctactgtatatgggtttttcaaattctagaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
10759774 |
atgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctactgtatatgggtttttcaaattccaaaa |
10759675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University