View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17077_high_4 (Length: 349)
Name: NF17077_high_4
Description: NF17077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17077_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 55396761 - 55396525
Alignment:
| Q |
18 |
ggttacatgttggacatccacttggatacactgcaactgatattctagctaggtttaaacgaatgcaaggatataatgtgttgcatccaatgggttggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55396761 |
ggttacatgttggacatccacttggatacactgcaactgatattctagctaggtttaaacgaatgcaaggatataatgtgttgcatccaatgggttggga |
55396662 |
T |
 |
| Q |
118 |
tgcttttggattgcctgcagaacaatatgctattcaggtctatttcttgctttttactatcactgacatactatgaagcaccaaccaacacttcttataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
55396661 |
tgcttttggattgcctgcagaacaatatgctattcaggtctatttcttgctttttactatcactgacatactattaagc----accaacacttcttataa |
55396566 |
T |
 |
| Q |
218 |
aaaatgtgtacaatgggtgtatggcacgacacggacacatg |
258 |
Q |
| |
|
| | |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
55396565 |
attttttgtacaatgggtgtatggcatgacacttacacatg |
55396525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 246 - 323
Target Start/End: Original strand, 55396461 - 55396538
Alignment:
| Q |
246 |
acacggacacatgtgattattattgcattcaattatgttattttctctactatttaccggcgtccatgtgtaagtgtc |
323 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55396461 |
acacagacacatgtgattattattgcattaaattatgttattttctctaatatttaccggcgtccatgtgtaagtgtc |
55396538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University