View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17077_low_4 (Length: 394)
Name: NF17077_low_4
Description: NF17077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17077_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 44461752 - 44462029
Alignment:
| Q |
19 |
tgaaggctgctttggctgctattactacctgcgataattctattcctggaaatgatgatgttttgtctgtcaagagtagaaccttccgcagactcaccaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44461752 |
tgaaggctgctttggctgctattactacctgcgataattctattcctggaaatgatgatgttttgtctgtcaagagtagaatcttccgcagactcaccaa |
44461851 |
T |
 |
| Q |
119 |
cattgttgttcttattaccagggccttgcctaaacgtacttcttctgtccaaccagtcaaagtgtaatttaaatcatctttgctctgtgctatatattat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44461852 |
cattgttgttcttattaccagggccttgcctaaacgtactccttctgcccaaccagtcaaagtgtaatttaaatcatctttgctctgtgc--tatattat |
44461949 |
T |
 |
| Q |
219 |
tgatcaagctcatatccttgttaaattttatgtgaatcttatatatatgattctatattattattaaagagtgttgttaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461950 |
tgatcaagctcatatccttgttaaattttatgtgaatcttatatatatgattctatattattattaaagagtgttgttaa |
44462029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 338 - 384
Target Start/End: Original strand, 44462068 - 44462114
Alignment:
| Q |
338 |
atgtgagaagaatgcaaaacaaaacaaaccggaaaacttgtcctatg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44462068 |
atgtgagaagaatgcaaaacaaaacaaaccggaaaacttgtcctatg |
44462114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University