View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17077_low_8 (Length: 308)
Name: NF17077_low_8
Description: NF17077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17077_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 104 - 292
Target Start/End: Complemental strand, 23668443 - 23668255
Alignment:
| Q |
104 |
cggtattttaaaatcttaggttgtcaataaatggtgtatgatagtaatgacggtgagttttacgaaattatgtagagtttaggatcttacacttttcaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||| | |||| ||| |
|
|
| T |
23668443 |
cggtattttaaaatcttaggttgtcaataaatggtgtatgatagcaatgacggtgagttttacgaaattacgtagagtttaggattttatattttttaac |
23668344 |
T |
 |
| Q |
204 |
gaattatgacgataatgtaattttgtcgaactcattgtgatatcaaatcatgcatttgtattttattttaagggtatggggaagaaaac |
292 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23668343 |
gaattatgacgataatgtaattttatccaactcattgtgatatcaaatcatgcatttgtattttattttaagggtatggggaagtaaac |
23668255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University