View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17079_high_1 (Length: 435)
Name: NF17079_high_1
Description: NF17079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17079_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 28800016 - 28799983
Alignment:
| Q |
158 |
acttctctacatttaaaaatgtgtgagctccaac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28800016 |
acttctctacatttaaaaatgtgtgagctccaac |
28799983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 191
Target Start/End: Original strand, 33579183 - 33579221
Alignment:
| Q |
153 |
atcatacttctctacatttaaaaatgtgtgagctccaac |
191 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
33579183 |
atcatacttctttatatttaaaaatgtgtgagctccaac |
33579221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 45268871 - 45268835
Alignment:
| Q |
113 |
attgcatattatatgcagagaccgaattcgaacctca |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45268871 |
attgcatattatatgcagagaccgggttcgaacctca |
45268835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University