View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17079_low_1 (Length: 435)

Name: NF17079_low_1
Description: NF17079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17079_low_1
NF17079_low_1
[»] chr7 (1 HSPs)
chr7 (158-191)||(28799983-28800016)
[»] chr8 (1 HSPs)
chr8 (153-191)||(33579183-33579221)
[»] chr3 (1 HSPs)
chr3 (113-149)||(45268835-45268871)


Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 28800016 - 28799983
Alignment:
158 acttctctacatttaaaaatgtgtgagctccaac 191  Q
    ||||||||||||||||||||||||||||||||||    
28800016 acttctctacatttaaaaatgtgtgagctccaac 28799983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 191
Target Start/End: Original strand, 33579183 - 33579221
Alignment:
153 atcatacttctctacatttaaaaatgtgtgagctccaac 191  Q
    ||||||||||| || ||||||||||||||||||||||||    
33579183 atcatacttctttatatttaaaaatgtgtgagctccaac 33579221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 149
Target Start/End: Complemental strand, 45268871 - 45268835
Alignment:
113 attgcatattatatgcagagaccgaattcgaacctca 149  Q
    ||||||||||||||||||||||||  |||||||||||    
45268871 attgcatattatatgcagagaccgggttcgaacctca 45268835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University