View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707R-Insertion-2 (Length: 137)
Name: NF1707R-Insertion-2
Description: NF1707R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707R-Insertion-2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 18355428 - 18355300
Alignment:
| Q |
8 |
agcaatgtgcatgcaaggaaaagagaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgctttttgg |
107 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18355428 |
agcaatgtgcatgcaaggaaatg-gaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcgg |
18355330 |
T |
 |
| Q |
108 |
cgctctctctcactctcttcttgttgttgc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18355329 |
cgctctctctcactctcttcttgttgttgc |
18355300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University