View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707R-Insertion-3 (Length: 149)
Name: NF1707R-Insertion-3
Description: NF1707R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707R-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 39745233 - 39745093
Alignment:
| Q |
9 |
gtcagtgccatcactatgcttgacaccattgtttgagagccagcattataatttacagcagtacgtgcaattggacctgcatatatggtttatttagtca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39745233 |
gtcagtgccatcactatgcttgacaccattgtttgagagccagcattataatttacagcagtacgtgcaattgaacctgcatatatggtttatttagtca |
39745134 |
T |
|
| Q |
109 |
tagttaatattaaaatatagcacactttattttgtactgga |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39745133 |
tagttaatattaaaatatagcacactttattttgtactgga |
39745093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University