View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707R-Insertion-4 (Length: 157)
Name: NF1707R-Insertion-4
Description: NF1707R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707R-Insertion-4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 6e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 33791419 - 33791539
Alignment:
| Q |
9 |
caaaacacttcttttgtgtttgatcatcaattttataatcagattttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccattt |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791419 |
caaaacacttcttttgtttttgatcatcaattttataatcagattttgttggggagaggtgtgttaacaattgaccagaatttggctctagattccattt |
33791518 |
T |
 |
| Q |
109 |
ccaaaggggttgtcacaggtt |
129 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33791519 |
ccaaaggggttgtcacaggtt |
33791539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University