View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707R-Insertion-5 (Length: 195)
Name: NF1707R-Insertion-5
Description: NF1707R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707R-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 33309148 - 33309334
Alignment:
| Q |
9 |
attactaccaatacgaatgcagagctagaagctatctctaacaatcttgagatgacttggagnnnnnnnnnaaggagcatggagtcatggtttttgctat |
108 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33309148 |
attactatcaatacgaatgcagagctggaagctatctctaacaatcttgagatgacttggagtttttttttaaggagcatggagtcatggtttttgctat |
33309247 |
T |
|
| Q |
109 |
tttaaaaaattgaggatggaattgtcaaacttttatttcaagaacaaaaatgatc-atttttgttattccatctatttacctcaaacc |
195 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33309248 |
tttaaaaaattgatgatggaattgtcacacttttatttcaagaac-aaaatgatcaatttttgttattccatctatttacctcaaacc |
33309334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 22081780 - 22081744
Alignment:
| Q |
9 |
attactaccaatacgaatgcagagctagaagctatct |
45 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
22081780 |
attactaccaatatgaatgcagagctacaagctatct |
22081744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University