View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707R-Insertion-8 (Length: 252)
Name: NF1707R-Insertion-8
Description: NF1707R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707R-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 35 - 252
Target Start/End: Complemental strand, 25803984 - 25803767
Alignment:
| Q |
35 |
aagcatattcttgatcttaatacatgcaagttttttgtttgacccaggcatagacttaaggcattcacatacatgcttcaaacataaatcacaccgtgtc |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25803984 |
aagcatattcttgatattaatacatgcaagttttttgtttgacccaggcatagacttaaggcattcacatacatgcttcaaacataaatcacaccgtgtc |
25803885 |
T |
 |
| Q |
135 |
tgagcataattccacaaaactgtaagccatgacatagaattaagcttcatttacaatcatcagatttaatattactgtcgttaatgtaactatgttttgt |
234 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25803884 |
tgagcataattccacaaaattgtaagccatgacatagaattaagcttcatttacaatcatcagatttaatattactgtcattaatgtaactatgttttgt |
25803785 |
T |
 |
| Q |
235 |
gcagcacctttggtatat |
252 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25803784 |
gcagcacctttggtatat |
25803767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University