View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_high_20 (Length: 340)
Name: NF1707_high_20
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 36865012 - 36865188
Alignment:
| Q |
19 |
ctaggttgacaccactcaagtacattttgaagtcctgaagatctttaaccacttggagaagttcgttgtagatggcaacgtcagaataaattatctcaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865012 |
ctaggttgacaccactcaagtacattttgaagtcctgaagatctttaaccacttggagaagttcgttgtagatggcaacgtcagaataaattatctcaaa |
36865111 |
T |
 |
| Q |
119 |
gttgtgactaaacaagacctttagtttttccaaatgctcaactaccttggaattacaagagtcttgactcttgagaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865112 |
gttgtgactaaacaagacctttagtttttccaaatgctctactaccttggaattacaagagtcttgactcttgagaa |
36865188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 194 - 333
Target Start/End: Original strand, 36865221 - 36865364
Alignment:
| Q |
194 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatg----catcaacattgagacgttcatc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36865221 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatgtatatatcaacattgagacgttcatc |
36865320 |
T |
 |
| Q |
290 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865321 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
36865364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University