View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_high_26 (Length: 298)
Name: NF1707_high_26
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 10 - 282
Target Start/End: Original strand, 39732005 - 39732274
Alignment:
| Q |
10 |
agatgaaagaagtacctcttttgcagctcataagagaagaaagacaacagattcaggtattcaatgtcatcatcatcttttaccgatttgattactagta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39732005 |
agatgaaagaagtacctcttttgcagctcataagagaagaaagacaacagattcaggtattcaatgtcatcatcatcttttaccgatttgattactagta |
39732104 |
T |
 |
| Q |
110 |
atgtcttttttatttatataaataaatagtagtaatgtcttctttgctatgtaacatgacatgctatgaaactagctagtaatgtcnnnnnnnnnnnnna |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39732105 |
atgtcttttttatttttataaataaatagcagtaatgtcttctttgctatgtaacatgatatgctatgaaactagctagtaatgtcttttattttat--- |
39732201 |
T |
 |
| Q |
210 |
tatatttataaataaataaatttgtagcggtgtcggtgtccaatgttttttgcatttatttagtagtgtcaac |
282 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39732202 |
tttatttataaataaatatatttgtagcggtgtcggtgtccaatgttttttgcatttatttagtagtgtcaac |
39732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 218 - 257
Target Start/End: Original strand, 4770479 - 4770518
Alignment:
| Q |
218 |
taaataaataaatttgtagcggtgtcggtgtccaatgttt |
257 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4770479 |
taaattaataaatttgtaacggtgtcggtgtccaatgttt |
4770518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University