View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_high_29 (Length: 281)
Name: NF1707_high_29
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 27832179 - 27831947
Alignment:
| Q |
20 |
gattccactaatcaccatattatgttgaatgaatcatcagttccaaattgttttaaaaactttctagtgtgtgtgaaccgactcagtgattcgattcatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832179 |
gattccactaatcaccatattatgttgaatgaatcatcagttccaaattgttttaaaaactttctagtgtgtgtgaaccgactcagtgattcgattcatg |
27832080 |
T |
|
| Q |
120 |
ttctttaaaatggctttggaaactttatagctctactgaatcgattcacaatgttgaaaatcacttccgagaaagtttttggagtgagtggatcaattca |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27832079 |
ttctttaaaatggcttgggaaactttatggctctactgaatcgattcacaatgttgaaaatcacttccgagaaagtttttggagtgagtggatcgattca |
27831980 |
T |
|
| Q |
220 |
taatacttatatgaatcgaatcacacgttgaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27831979 |
taatacttatatgaatcgaatcacacgttgaaa |
27831947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University