View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_high_38 (Length: 245)
Name: NF1707_high_38
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 33 - 231
Target Start/End: Complemental strand, 8813349 - 8813151
Alignment:
| Q |
33 |
tatgttgataaggtcattcattagttccagctgtattgaaaaataagagtgaagacaaagcaagttgaacatgagagaatatccgacacttgataaatct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8813349 |
tatgttgataaggtcattcattagttccagctgtattgaaaaataagagtgaagaaaaaggaagttgaacatgagagaatatccgacacttgataaatct |
8813250 |
T |
 |
| Q |
133 |
ggtgcattctttaataataagtgcttgagtattcgctttagtgaggattcatgtttttagaggctactattatttatttgcttcaattgattgaccttg |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8813249 |
ggtgcattctttaataataagtgcttaagtattcgctttagtgaggattcatgtttttagaggctactattatttatttgcttcaattgattgaccttg |
8813151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University