View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_high_6 (Length: 470)
Name: NF1707_high_6
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 23 - 272
Target Start/End: Complemental strand, 18355428 - 18355177
Alignment:
| Q |
23 |
agcaatgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18355428 |
agcaatgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaaaagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggc |
18355329 |
T |
|
| Q |
123 |
gctctctctcactctcttcttgttgttgcttgttttcaggcggcggggaaacaatgaagcgaaggtttcacctttcaacttatacaacaagctaaaccca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18355328 |
gctctctctcactctcttcttgttgttgcttgttttcaggcggcggggaaacaatgaagcaaaggtttcacctttcaacttatacaacaagctaaaccca |
18355229 |
T |
|
| Q |
223 |
caaacaattaaataaaac--aaaatataaatattttttattttcttctaaaa |
272 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18355228 |
caaacaattaaataaaacaaaaaatataaatattttttattttcttctaaaa |
18355177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 310 - 399
Target Start/End: Complemental strand, 18355107 - 18355017
Alignment:
| Q |
310 |
gacaaacttttatcatattgaattgtttccggtcttatgcaatattttatagatataatgtta-ttttagtatttttgacaaattgcactt |
399 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| |||| |||||| |||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
18355107 |
gacaaatttttatcgtattgaattgtttccggtcttatacaattttttatggatataatgttacttttggtattttagacaaattgcactt |
18355017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University