View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_low_1 (Length: 756)
Name: NF1707_low_1
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_low_1 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 161; Significance: 2e-85; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 109 - 281
Target Start/End: Original strand, 19727 - 19899
Alignment:
| Q |
109 |
cgcaaatatcatgaaaattctttcagatctagttgcggttgcatcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19727 |
cgcaaatatcatgaaaattctttcagatctagttgcggttgcagcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttg |
19826 |
T |
 |
| Q |
209 |
agcagacttaatgcaaatgttacatttacttttgtttcttgaaatgttgggaattatagaaaataagtttgtt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19827 |
agcagacttaatgcaaatgttacatttacttttgttccttgaaatgttggcaattatagaaaataagtttgtt |
19899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 5e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 647 - 728
Target Start/End: Original strand, 23656921 - 23657002
Alignment:
| Q |
647 |
acccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagcccta |
728 |
Q |
| |
|
||||||||||||||||||||||| |||||| | |||||||||||||||||||| |||||| |||| |||||||||||||||| |
|
|
| T |
23656921 |
acccgtttagaccgacccgcacgtcaacgggccattcggaccggacggtttggaccggatggctggtttttgtccagcccta |
23657002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 647 - 727
Target Start/End: Complemental strand, 4588612 - 4588532
Alignment:
| Q |
647 |
acccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagccct |
727 |
Q |
| |
|
||||||||||||||||||||||| |||||| | |||||||||||||||||||| |||||| |||| ||||||||||||||| |
|
|
| T |
4588612 |
acccgtttagaccgacccgcacgtcaacgggccattcggaccggacggtttggaccggatggctggtttttgtccagccct |
4588532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 132 - 244
Target Start/End: Complemental strand, 3001706 - 3001600
Alignment:
| Q |
132 |
cagatctagttgcggttgcatcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttgagcagacttaatgcaaatgttac |
231 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| || ||||||| ||||||||||| ||||||||||||||| || ||||||||| || |
|
|
| T |
3001706 |
cagatctagttgcggttgcagcttgtcttctt------gaatcaaatatggaagcatgtgtagatctatgaaccttgagcagatttgatgcaaatgctat |
3001613 |
T |
 |
| Q |
232 |
atttacttttgtt |
244 |
Q |
| |
|
| ||| ||||||| |
|
|
| T |
3001612 |
agttatttttgtt |
3001600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 634 - 727
Target Start/End: Original strand, 43109127 - 43109220
Alignment:
| Q |
634 |
tcaaaaccggttcacccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagccct |
727 |
Q |
| |
|
||||||| | || ||||||||||||||| |||||||||||| | | ||||||||||| |||||||||| || || | ||||||||||||||||| |
|
|
| T |
43109127 |
tcaaaactgttttacccgtttagaccgatccgcacgccaacaggccattcggaccgggcggtttgggctggttaacagttttttgtccagccct |
43109220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 630 - 728
Target Start/End: Original strand, 19534001 - 19534099
Alignment:
| Q |
630 |
cccgtcaaaaccggttcacccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagcccta |
728 |
Q |
| |
|
||||||||||||| || || |||||||| |||| ||||||||||| | ||||||||||| ||||||||||||| | | |||||||||||||||||| |
|
|
| T |
19534001 |
cccgtcaaaaccgttttacttatttagaccaacccacacgccaacgggccattcggaccgggcggtttgggccggttgacagttttttgtccagcccta |
19534099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 536 - 728
Target Start/End: Original strand, 24215123 - 24215315
Alignment:
| Q |
536 |
tatgcagtataatcggtcggctttgggttatcgtggatgaatttctaccatccgaaccgaaccgtgccaatccatgccaaaccggatctgtgagcccgtc |
635 |
Q |
| |
|
||||||| |||| ||||||| ||||||| ||||| ||||||| ||| ||||||| | ||||| | |||||| | ||||| |||| ||||||| |
|
|
| T |
24215123 |
tatgcagcataaacggtcggtaatgggttaccgtggttgaatttttacaatccgaaaccgaccgtacgaatccacacagaaccgaatctacaagcccgtt |
24215222 |
T |
 |
| Q |
636 |
aaaaccggttcacccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagcccta |
728 |
Q |
| |
|
|||||| || |||| | || ||||||||||| | |||||| | ||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24215223 |
gaaaccgctttacccatctaaaccgacccgcaagtcaacgggccattcggatcggacggtttgggccggtcgactgttttttgtccagcccta |
24215315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 644 - 730
Target Start/End: Complemental strand, 36067419 - 36067333
Alignment:
| Q |
644 |
ttcacccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttttttgtccagccctagc |
730 |
Q |
| |
|
||||||||||| | ||||||||||||||||||| | ||||||||||| | ||||||| ||||| || ||| ||||||||||||||| |
|
|
| T |
36067419 |
ttcacccgtttgggccgacccgcacgccaacgggccattcggaccgggcagtttgggtcggatggccctttcttgtccagccctagc |
36067333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 615 - 728
Target Start/End: Original strand, 40159320 - 40159433
Alignment:
| Q |
615 |
aaccggatctgtgagcccgtcaaaaccggttcacccgtttagaccgacccgcacgccaacggactattcggaccggacggtttgggccggatagctgttt |
714 |
Q |
| |
|
|||||||||| ||||||| |||||| || |||| | || ||||||||||| | |||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
40159320 |
aaccggatctacaagcccgttgaaaccgctttacccatctaaaccgacccgcaagtcaacgggccattcggatcggacggtttgggccggtcgactgttt |
40159419 |
T |
 |
| Q |
715 |
tttgtccagcccta |
728 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40159420 |
tttgtccagcccta |
40159433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University