View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_low_38 (Length: 249)
Name: NF1707_low_38
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_low_38 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 43455754 - 43455996
Alignment:
| Q |
7 |
agattatactgtggatgccacgacagtagtgttcaggtatcaagttttaagaagtacgacatagcctaaatccaatgtgatgctatctcaacttgagtat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43455754 |
agattatactgtggatgccacgacagtagtgttcaggtatcaagttttaagaagtacgacatagcctaaatccaatgtgatgctatctcaacttgagtat |
43455853 |
T |
 |
| Q |
107 |
gtgatgttatctcgacatatttgtgataataatattgtcatatttcaggagatacatttggccactggaactatcagtaatattcaaagtggttctaaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43455854 |
gtgatgttatctcgacatatttgtgataatattattgtcatatttcaggagatacatttggccactggaactatcagtaatattcaaagtggttctaaaa |
43455953 |
T |
 |
| Q |
207 |
gattacttgggaaagcatatcctattcatgcactgcaagttca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43455954 |
gattacttgggaaagcatatcctattcatgcactgcaagttca |
43455996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University