View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1707_low_39 (Length: 247)
Name: NF1707_low_39
Description: NF1707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1707_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 232
Target Start/End: Complemental strand, 35467307 - 35467080
Alignment:
| Q |
5 |
tttctgtgacccaacccaaaactttggaatattttagatttaaatactttcagcgggttttggtttggtcttgcggatttt-gttcattctctcattttt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
35467307 |
tttcagtgacccaacccaaaactttggaatattttagatttaaatactttcagcgggttttgatttggtcttgcgtatttttgttcattctctcattttt |
35467208 |
T |
 |
| Q |
104 |
attatttaatatattggtgccacaaaaacctattagtgtatttagtgtcaatttagttgagatgactttgcatcgatgatatttttcacataaaagaaaa |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35467207 |
attatttaatatattgatgccacaaaaacctattagtgtatttagtgtcaacttagttgagatgac-ttgcatcgatgatatttttcacataaaagaaaa |
35467109 |
T |
 |
| Q |
204 |
gactagggggcataagcttagttgagaag |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35467108 |
gactagggggcataagcttagttgagaag |
35467080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University